jonellelewis6758 jonellelewis6758
  • 22-02-2024
  • Mathematics
contestada

How far do they walk if it took them 6 hours with 3 periods of 15 minutes?

a) 18 km
b) 15 km
c) 21 km
d) 24 km

Respuesta :

Otras preguntas

1) If X = 2, calculate the value of: 2x squared - x 2) if X = -2, calculate the value of: 2x squared -x
Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC
if an element has more than one ionic change how is that piece of information represented in the chemical name
During a cesarean section, an incision is made through all EXCEPT which of the following? A)linea alba B)perimetrium C)superficial fascia D)decidua basalis
plz help what is the answer.
what is thunder is cause by?
Discuss at least two effects on U.S. citizens that stem from the division of power between the federal and state governments.
Please help me answer these questions
what is the credit card balance? A-The amount of interest you must pay the credit card company. B-The required minimum payment to your credit card company. C-A
The inferior hypogastric plexus is the site of synapse between sympathetic preganglionic and postganglionic neurons for: a. Part of the foregut b. All of the fo