kaanan8459 kaanan8459

22-05-2023
Biology

contestada

Which of the strands of DNA could act as a primer for the DNA sequence shown below? 5 ' CCCTGGGCTCTGTAAATGTTTCTAAGTG -3' 3' GGGACCCGAGACATTTACAAAGATTCAC -5' A: 3'-ACTGTTAGA-5' B: 3' -AAATTTGGC-5' C: 3' -ATGCTTTGA-5' D: 5' -GGGACCCGA-3' E: 5' CCCTGGGCT-3'

Respuesta :

Otras preguntas

Chinesse came to the us in 1800s for

The main idea of Lee’s “Letter to His Son” could be expressed best as a. belief that the integrity of the Union must be preserved at all costs. b. determinati

China is often called a subcontinent. a. True b. False

What did the use of atomic bombs during World War II lead to? a ban on all nuclear weapons for all developed countries for years in the future the need for a gl

how did the roman republic influence the american form of government

When the Fed adjusts its interest rate, it directly influenced consumer?

Please answer quickly!!!! I really need it! Whoever answers first gets BRAINLIEST ANSWER!!!!!!!

People around the world rely on the Amazon Rainforest for all of the following resources except __________. a. water b. medicinal resources c. oil d. oxygen

the wavelength of a wave is the distance between

What do erosion mean?